An Interview with Joe Davis
Part 2

Jeremy Hight: How has your experience and position at Harvard been different from your time at MIT?

Joe Davis: I currently hold appointments at both institutions and there are certain differences in atmosphere, and perhaps even in what you might call "energy," but these differences are probably idiosyncratic, stemming from the personality and disposition of colleagues in particular laboratories, rather than being in any sense characteristic of either institution as a whole. I can say that the laboratory of George Church at Harvard is unusually large and so, more diverse and farther reaching than the generally smaller laboratories I have interacted with over the past several decades. Nevertheless, I routinely encounter great minds both at MIT and Harvard, and the combination of resources cannot be compared any individual institution anywhere. Think Oz.

JH: Which of your works have been the most interesting to you as far as process, results and opening new possibilities?

JD: I think I would probably always like to answer this question by saying that my current project is the most interesting project, but then, I almost always involve myself in at least several concurrent projects. One I am particularly excited about is an international consortium I have organized this year devoted to resolving the sequence of the genome of Malus sieversii, a wild apple from central Asia that is the common ancestor of all domestic apples. More than 25 scientists and a dozen laboratories worldwide have become involved. We expect to find genes that will help domestic apples cope with disease and climate change. And since this apple is of such ancient lineage, we expect to answer some questions that are important to evolutionary biology as well. As of last week, a plan has been hatched to incorporate encyclopedic information (Wiki) into the forthcoming Malus sieversii genome. I have personally devoted several decades to strategies for keeping the poetic and intellectual legacy of humanity within the vast, deep-time genetic archive of the terrestrial biome and, as you are probably already aware, George Church published the first entire book in DNA form, about one year ago. This aspect of the project thus far involves George Church, Microvenus collaborator Dana Boyd, and several other colleagues at Harvard. In the end, we will indeed have a "Tree of Knowledge" and perhaps, some apples to tempt the devil.

I will attach an image of a paper model of a prospective sculpture for the new Biomedical Building at Karolinska Institute in Stockholm. This is one of several sculptures incidental to Malus sieversii sequencing project. Another has already been permanently been installed in a courtyard adjacent to the Chemistry Building at South Dakota School of Mining and Technology in Rapid City. Still another is planned for an atrium at Harvard Medical School in Boston.

I think another particularly interesting project is one I call, "Swansong." As a result of my 2009 experience with the Rubisco Stars project, a flurry of responses were forthcoming from the international SETI community as well as from many other astronomers and astrobiologists. Some among these were convinced that for various reasons, I am in a special position to arrange for further transmissions and enthusiastically suggested future candidate targets for METI (messages for extraterrestrial intelligence). There were, for instance, some suggestions that I should look for infrared sources without obvious stellar companions, assuming that these may be so called, "Dyson Spheres" that could harbor advanced intelligences. Still others suggested—for entirely different reasons—that I should be sending messages toward certain black holes. It is assumed that not even a black hole can separate a magnetic field from an electric field and that an electromagnetic wave transmitted at certain angles into the polar node of a rapidly rotating "Kerr object" may be stretched but not destroyed. Since Kerr objects are so massive, and since they are rotating at relativistic velocities, these black holes drag spacetime with them in a phenomenon physicists call "frame dragging." Space and time are thought to be profoundly smeared in the vicinity of Kerr objects. According to some general relativists, if a signal were to pass through a Kerr object at an appropriate angle of incidence, it could emerge in a remote region of spacetime within our own universe, past, present, or future; into another universe, or perhaps into some sort of strange, parallel universe. Of course, even if these suggestions have merit, such a message could wind up emerging in far distant space-time. Still, in the exceedingly unlikely event that human beings will/could/would have detected it (I have a problem with tense here) sometime within the past 78 years, we could perhaps preemptively change our past/future. Unless we ourselves actually receive a message from some other time and place, no one would ever know whether or not the message is/was/would have been received. The timeline will either change or not.

This may seem a little creepy, but it may already have. H.G. Wells published a novel in 1937 dedicated to his friend Winston Spencer Churchill. That story is about Joseph Davis and biological messages from space. Note that in 1937, Winston Churchill had early radar. See http://ebooks.adelaide.edu.au/w/wells/hg/w45st/index.html.

If such a message were shifted far enough into the past (and given a sufficiently powerful signal) it wouldn't matter if the targeted Kerr object happens to be thousands of light years away. A still unsent message may have already arrived. The message would be English language transmitted as International Morse Code.

One candidate target object is Cygnus X-1, a rapidly rotating black hole located about 6,070 light years away from us in the constellation Cygnus (The Swan).

Suggested message content follows (to be updated immediately before transmission):

SOS SOS SOS
CQ EARTH CQ EARTH CQ EARTH DE EARTH 2013
CQ EARTH CQ EARTH CQ EARTH DE EARTH 2013
CQ EARTH CQ EARTH CQ EARTH DE EARTH 2013
SOS SOS SOS

[This preamble repeated 2 to 4 times, mainly to give flabbergasted listeners time to grab pencil or recording device + witnesses. Proceeding with condensed message including transmission date, transmit site, and that a black hole is being used as temporal relay.]

[JOE DAVIS (and/or other sender) DATE/SITE] USING RAPIDLY ROTATING OBJECT IN [CYGNUS] AS TEMPORAL RELAY.
SOS SOS SOS
2SEPT1935 HURRICANE FLA MID KEYS. EVAC IMPOSSIBLE. 408 KILLED.
6MAY1937 AIRSHIP LZ 129 HINDENBURG EXPLODES WHILE DOCKING WITH MOORING MAST AT LAKEHURST NAVAL AIR STATION IN OCEAN COUNTY NJ USA 13 PASSENGERS 22 CREW 1 GROUND CREW KILLED.
DEC1937 JAPAN ARMY KILLS 300,000 CIVILIANS, SOLDIERS NANKING CHINA. 20,000-80,000 FEMALES RAPED.
1938-1945 GERMAN NAZI REGIME KILLS 12 MILLION CIVILIAN CAPTIVES. GENOCIDE OF JEWS, JOHOVA'S WITNESSES, ROMANIS, SOCIAL DEMOCRATS, COMMUNISTS, TRADE UNIONISTS, HOMOSEXUALS, HANDICAPPED AND SOVIET POWS. DEATH CAMPS AT DACHAU, AUSCHWITZ-BIRKENAU, BELZEC, CHELMNO, MAJDANEK, SOBIBOR, BELSEN, BUCHENWALD, TREBLINKA. MILLIONS MORE DIE IN GHETTOS, CONCENTRATION CAMPS BY FORCED LABOR, STARVATION, EXPOSURE, BRUTALITY, DISEASE, EXECUTION.
WORLD WAR 1939-1945 NAZIS INVADE POLAND 1939. 62 MILLION KILLED IN EUROPE, ASIA, S. PACIFIC. 40-52 MILLION CIVILIANS KILLED. 22-25 MILLION MILITARY CASUALTIES. DEADLIEST CONFLICT. US AND BRITISH BOMBING KILL 500,000 GERMAN CIVILIANS.
6AUG1945 U.S. ATOMIC BOMB "Little Boy" dropped on Hiroshima 90,000-166,000 KILLED. "Fat Man" detonation over Nagasaki 9Aug. 60,000-80,000 killed. MOST are CIVILIANs.
1945-1987 VIETNAM COMMUNIST PARTY KILL 1.7 MILLION
British India Partition by RELIGIOUS DEMOGRAPHICS LEAD TO DOMINION OF PAKISTAN 14Aug1947; secular Union of India 15Aug1947. displaces 12.5 million. 1 million KILLED.
N. KOREAN KIM IL SUNG REGIME 1948-1994 PURGES, CONCENTRATION CAMPS. 1.6 MILLION KILLED
1965 CHINA "CULTURAL REVOLUTION" PURGE. 3 MILLION KILLED. 100 MILLION PERSECUTED. VAST CHINESE CULTURAL LEGACY DESTROYED.
1967-1970 NIGERIAN-BIAFRAN WAR 100,000 MILITARY CASUALTIES. 2 MILLION BIAFRAN CIVILIANS (IBOS, MINORITIES S.E. NIGERIA) DIE OF STARVATION DURING WAR.
HURRICANE CAMILLE MISSISSIPPI COAST 17AUG1969. 400 KILLED.
LAOS 1961-1975 U.S. SECRET WAR. MOST BOMBED NATION IN HISTORY. 3 MILLION TONS BOMBS. 450,000 CIVILIANS KILLED
1966-2003 UGANDAN GENOCIDE: 400-1,000 BAGANDA KILLED 1966-1971. AMIN REGIME 1971-1979 100,000-500,000 Acholi, Langi, OBOTE SUPPORTERS, INTELLECTUALS KILLED. 1978-1979 UGANDA-Tanzania war 4,000 Amin sympathizers, AnkoleMasaka Muslims, people of West Nile, Nubians, LiByANS, TANZANIANS, RWANDANS, CONGOLESE, NAMIBIANS KILLED. second Obote administration 1980-1985 targets Baganda. govt and guerrilla armies in Luwero Triangle cause 300,000 deaths. northern Uganda Acholi region terrorized 1986-2003. 100,000 killed, 20,000 children abducted.
1969-1973 U.S. BOMBS N. VIETNAMESE SANCTUARIES E. CAMBODIA. 150,000 CAMBODIAN PEASANTS KILLED.
12Nov1970 cyclone E. Pakistan; W. Bengal. surge KILLS 500,000 GANGES DELTA ISLANDS FLOOD. DISEASE, STARVATION DOUBLE CASUALTIES in following months.
E. PAKISTAN 25MAR - 16DEC1971 Pak Army/ militias RAPE, KILL 300,000 MOSTLY Hindu civilians. Bangladeshi nationalists subject non-BengaliS, BIHARI MUSLIMS TO REPRISALS AFTER PAKISTANI DEFEAT. ADDITIONAL 100,000 DEATHS.
KHMER ROUGE SEIZE CAMBODIA 17APR1975. FORCE EVAC CITIES. 2 MILLION EVAC FROM PHNOM PENH TO COUNTRYSIDE WITH 20,000 KILLED. EDUCATED, WEALTHY, BUDDHIST MONKS, POLICE, DOCTORS, LAWYERS, TEACHERS, FORMER GOVT OFFICIALS, EX-SOLDIERS KILLED WITH WIVES AND CHILDREN. 200,000 ETHNIC CHINESE, VIETNAMESE, CHAM MUSLIMS, OTHERS KILLED. 2 MILLION KILLED 1975-1979.
Typhoon Nina 8AUG1975 SHIMANTAN RESERVOIR DAM, BANQIAO RESERVOIR DAM AMONG 62 Zhumadian PREFECTURE dams Henan Province FAIL OR INTENTIONALLY DESTROYED. 90,000 - 230,000 KILLED.
ETHIOPIA 1975-78 MENGISTU HAILE MARIAM PURGES, EXECUTIONS KILL 1.5 MILLION
60 MILLION PEOPLE INFECTED WITH HUMAN IMMUNO-DEFICIENCY VIRUS (HIV) GLOBAL PANDEMIC BEGINS MID- LATE 1970S. HIV spreadS to n. America, S. America, Europe, Africa and Australia By 1980. PROBABLE AFRICA ORIGIN. 33.4 million with HIV BY 2009. 25 MILLION PEOPLE DIE HIV-RELATED CAUSES BY 2010. AIDS (acquired immune deficiency syndrome) final stage HIV DISEASE. SEVERE IMMUNE SYSTEM DAMAGE. 2.7 MILLION/ YR HIV INFECTED AND 2 MILLION DIE. HIV multiplies in immune system CD4+ T cells. kills vast numbers of infectED cells. TRANSMISSION BY blood, semen, VAGINAL SECRETIONS AND BREAST MILK. NO CURE.
HIV-1 RNA (RIBONUCLEIC ACID) PARTIAL SEQUENCE:
GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACCCACUGCUUAAGCCUCAAUAAAGCUUGCCUUGAGUGCUUCAAGUAGUGUGUGCCCGUCUGUUGUGUGACUCUGGUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGUGUGGAAAAUCUCUAGCAGUGGCGCCCGAACAGGGACCUGAAAGCGAAAGGGAAACCAGAGGAGCUCUCUCGACGCAGGACUCGGCUUGCUGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACUGGUGAGUACGCCAAAAAUUUUGACUAGCGGAGGCUAGAAGGAGAGAGAUGGGUGCGAGAGCGUCAGUAUUAAGCGGGGGAGAAUUAGAUCGAUGGGAAAAAAUUCGGUUAAGGCCAGGGGGAAAGAAAAAAUAUAAAUUAAAACAUAUAGUAUGGGCAAGCAGGGAGCUAGAACGAUUCGCAGUUAAUCCUGGCCUGUUAGAAACAUCAGAAGGCUGUAGACAAAUACUGGGACAGCUACAACCAUCCCUUCAGACAGGAUCAGAAGAACUUAGAUCAUUAUAUAAUACAGUAGCAACCCUCUAUUGUGUGCAUCAAAGGAUAGAGAUAAAAGACACCAAGGAAGCUUUAGACAAGAUAGAGGAAGAGCAAAACAAAAGUAAGAAAAAAGCACAGCAAGCAGCAGCUGACACAGGACACAGCAAUCAGGUCAGCCAAAAUUACCCUAUAGUGCAGAACAUCCAGGGGCAAAUGGUACAUCAGGCCAUAUCACCUAGAACUUUAAAUGCAUGGGUAAAAGUAGUAGAAGAGAAGGCUUUCAGCCCAGAAGUGAUACCCAUGUUUUCAGCAUUAUCAGAAGGAGCCACCCCACAAGAUUUAAACACCAUGCUAAAC
mag 8.2 Tangshan Earthquake 19:42:53.8 GMT 27Jul1976 aftershock 7.8 MAG 16 HRS LATER INCREASING DEATH TOLL. epicenter Tangshan. 650,000 - 700,000 KILLED.
NIGHT 2-3 DEC1984 BHOPAL UNION CARBIDE INDIA LTD CARBARYL PESTICIDE PLANT LEAKS METHYL ISOCYANATE, OTHER TOXICS 20,000 KILLED, MANY THOUSANDS MORE OVER TIME
STS ROCKET BOOSTER SEGMENT O-RINGS FAIL IN COLD DESTROY CHALLENGER SHUTTLE 28JAN1986
26APR1986 REACTOR 4 CHERNOBYL NUCLEAR PLANT Pripyat Ukraine fails in unsafe low power systems test. Emergency shutdown attempt leads to reactor vessel rupture and series of explosions. Graphite moderator exposed to air and ignited; FALLOUT PLUME RELEASED OVER LARGE PARTS OF THE WESTERN Soviet Union, Eastern, Western, AND Northern Europe. 50 direct deaths incl. 9 children with thyroid cancer; estimated 4,000 cancer deaths over time. 336,000 resettled.
Rwandan Genocide: 800,000 killed 100 days from 6Apr Juvénal Habyarimana assassination THRU mid-Jul1994. Tutsi REBELS invade n. Rwanda from Uganda 1990. Hutus displaced in north. Hutus exterminatE Tutsi IN south. Habyarimana assassination proximate cause mass killing of Tutsis, pro-peace Hutus by Interahamwe and IMPUZAMUGAMBI militias. genocide directed by Hutu Akazu power group.
1996-2010 DEMOCRATIC REPUBLIC OF CONGO (FMR ZAIRE) CIVIL WAR. CIVILIANS TARGETED. MILLIONS DIE OF MALNUTRITION, DISEASE. 7.5 MILLION KILLED
19 al-Qaeda ISLAMIC terrorists hijack 4 airliners morn. 11Sept2001. 2 airliners crashed into NYC World Trade Center Twin Towers killing ALL PASSENGERS, THOUSANDS in buildings. towers collapse within two hours. nearby buildings destroyED, damagED. 3RD airliner crashed into Pentagon Arlington, Va. 4TH plane crashes near SHANKSVILLE, Pa after passengers, flight crew attempt retake control. no survivors flights AMERICAN 11, UNITED 175, AMERICAN 77, UNITED 93 HIJACKED WITH KNIVES, RAZOR BOX-CUTTERS. 2,995 KILLED.
2002 IRAQ NO WEAPONS MASS DESTRUCTION
STS FUEL TANK FOAM SHEDDING DAMAGE TILES DESTROY COLUMBIA SHUTTLE 01FEB2003 ON REENTRY
FEB2003 ongoing civil war DARFUR region SUDAN BY MUSLIM ARABS VS CHRISTIAN, ANIMIST BLACK AFRICANS, NON-ARAB MUSLIMS. 300,000 killed DIRECT COMBAT, CIVILIAN MURDERS, STARVATION, DISEASE. 51 Intl peacekeepers killed.
2004 Ocean earthquake 00:58:53 GMT 26Dec2004 epicentre off w. SUMATRA. Indian Ocean coast TSUNAMIS 30 M waves. 230,000 KILLED 14 countries. Indonesia hardest hit THEN Sri Lanka INDIA Thailand.
2011 Tōhoku earthquake and tsunami A 9.0-MAG UNDERSEA EARTHQUAKE off NE JAPAN COAST 14:46 JST (05:46 UTC) 11MARCH2011 EPICENTER 72 KILOMETERS EAST OF THE Oshika Peninsula. Earthquake triggered extremely destructive TSUNAMI waves of up to 23.6 m struck Japan minutes after quake traveling up to 10 km inland. Tsunami CAUSES SEVERAL REACTOR CORE MELTDOWNS AT Fukushima Dai-ichi power plant, 220 kM northeast of Tokyo WITH SUBSEQUENT RELEASE OF CONTAMINATED WATER AND GASSES 18,000 people KILLED HUNDREDS OF THOUSANDS HOMELESS
2011 HUMAN ACTIVITY SINCE INDUSTRIAL REVOLUTION contributEs to climate change. increased radiative forcing FROM CO2, METHANE, TROPOSPHERIC OZONE, CFCs AND nitrous oxide. ATMOSPHERE CO2 concentration rises by 36 PERCENT methane BY 148 PERCENT since 1750. 650,000 yrs highest levels. CO2 values highest 20 million yrs. Fossil fuel USE PRODUCES 3/4 OF CO2 INCREASE FROM HUMAN ACTIVITY PAST 20 YRS. REMAINDER DUE TO deforestation. NEAR-SURFACE AIR AND OCEAN TEMP INCREASE SINCE MID-20TH CENTURY. 21RST CENTURY INCREASES PROJECTED. SCIENTISTS CALL FOR EMISSIONS CUTBACK. CATASTROPHIC ENVIRON CONSEQUENCES PREDICTED.

We acknowledge that like the universe around us, we are of BOTH violent and peaceful nature. It is from precisely this DUALITY that We derive our humanity. It does little good to apologize for past atrocities. Instead we are driven to evolve into more conscientious beings capable of the promise and aspirations that also underlie the history of our experience.

JH: What recent developments in science and technology are most resonant to you?

JD: The quest for dark matter/energy is a quest to resolve one of the most intriguing mysteries of all. My colleagues at Church Lab have contributed to the design of an unusual instrument that will use single-stranded DNA as a dark matter detector and have a resolution of 2 nm, much higher resolution than all of the existing instrumentation of physics.

Dark matter detectors are located as deep as 1 mile underground in order to diminish background interference from another mysterious entity (or, entities) that we collectively call "cosmic rays." Cosmic rays are made up of a wide range of highly energetic subatomic particles, electrons, protons and atomic nuclei that bombard the Earth from every direction. No one knows where they come from or why there seems to be a regular flux in the population of such particles every few minutes. Cosmic rays pose a particular dangerous radiation hazard to astronauts who endure long periods in space. And, since Earth’s thick atmosphere and strong magnetic field absorb or deflect significant numbers of these particles, explorers on the moon and mars would also face increased risk of radiation damage where there is no or little atmosphere and weak or nonexistent planetary magnetic fields.

Some work has been carried out to observe interactions of DNA and x-rays, but little or no research has gone into the study of cosmic ray/DNA interactions. Cosmic ray damage to DNA will make up background noise in our DNA-based dark matter detector even if it is placed deep underground. At my MIT laboratory I have been mounting experiments with visually striking cosmic ray detectors called "cloud chambers." I hope to characterize various kinds of cosmic ray DNA damage with these instruments and special, micro graduated glass and plastic slides that hold "curtains" of identical single-stranded DNA molecules. I have also modified detectors formerly used with my audiomicroscope projects to resolve acoustic signatures of super-cooled droplets of alcohol that are condensed in cloud chambers as a result of passing cosmic rays. The striking visual character of these instruments has obvious sculptural implications that I also plan to explore later this academic year.

JH: Has your work in poetry and performance influenced your later works?

JD: As I mentioned above, I consider these activities to be avocational or recreational. Although I will occasionally get roped into playing with bands, I am a musician with no ambition. If you want to hear me recite one of my poems you will usually have to buy me a beer.

JH: Is it problematic how labels are given to fields and sub-fields of art, of art and science as different hermetic hemispheres?

JD: This is what I call Mnemosyne's Paradox, and to be fair, it should be the subject of another interview.

JH: How is your lightning aggregator/memorial progressing?

JD: A 1:10 scale model has been built and tested for hurricane-force wind loading at MIT. High voltage tests have also been carried out in Boston with 1.0 megavolt discharges and there has been some evidence of emission. I have designed a temporary 32-ft version that will be the first version to be actually powered by natural lightning but this will cost several thousands, perhaps as much as 10 thousand dollars to build. I have found permission to install the device at a site that will be visually, but not physically accessible to the public. I will also have to invest in all-weather monitoring equipment. Eventually I will find the funds.


Check out a selection of images by Joe Davis in this issue of Unlikely Stories: Episode IV!


Jeremy Hight is the Art Director at Unlikely Stories: Episode IV. You can learn more about him at his bio page.



Pin It       del.icio.us